How can colitis reshape DNA methylation?
Inflammation can leave an epigenetic record
Ulcerative colitis does not simply “switch methylation on.” Chronic inflammation changes signaling, oxidative stress, cell turnover, tissue repair, and the mixture of epithelial and immune cells in a biopsy. Together, these processes are associated with gains of methylation at some genomic regions and losses at others.
First: what is being methylated?
DNA methylation commonly adds a methyl group to carbon 5 of cytosine, creating 5-methylcytosine (5mC). In human DNA, this most often occurs at a CpG dinucleotide:
The synthetic sequences below contain the same bases. Gold 5mC marks show methylated cytosines specifically where a C is followed by G. They are an educational example, not a real patient locus.
LOW CpG METHYLATION
5′–ATCGTTACCGGAATCGCTCG–3′
CpGs are present; most cytosines are unmarked.
HIGH CpG METHYLATION
5′–AT5mCGTTAC5mCGGAAT5mCGCT5mCG–3′
The same CpGs carry methyl groups on most cytosines.
5′—C—p—G—3′
CH₃
→
Context-dependent change in chromatin and transcription
“CpG” means cytosine followed by guanine on the same DNA strand, with the p representing the phosphate linkage. It is a sequence motif, not the pairing of C with G across the two strands.
What are CpG islands?
CpGs are relatively uncommon across much of the human genome, but some short regions contain many of them. These CpG islands are often found at or near gene promoters and transcription start sites. Exact computational definitions vary, but they generally use region length, GC content, and observed-versus-expected CpG frequency.
The surrounding geography also matters:
| Region | Approximate relationship | Why it matters |
|---|---|---|
| CpG island | CpG-rich core, often promoter-associated | Frequently unmethylated at active or poised promoters |
| Shore | Up to roughly 2 kb from an island | Often shows tissue- and disease-associated variation |
| Shelf | Approximately 2–4 kb from an island | Can carry additional tissue-specific patterns |
| Open sea | Isolated CpGs farther from islands | Much of the genome; often more methylated, with context-specific regulation |
Not every promoter contains an island, and not every island controls a gene in the same way.
Why might colitis alter the pattern?
Several mechanisms may operate together:
- Inflammatory signaling. Cytokine pathways—including TNF, IL-6, and NF-κB-related signaling—change transcription and chromatin-regulatory activity.
- Oxidative and nitrosative stress. Reactive molecules can damage DNA and alter repair, replication, and the recruitment or activity of epigenetic enzymes.
- Repeated epithelial turnover. Injury forces intestinal stem and progenitor cells through repeated repair cycles. Methylation patterns can drift or be selected as clones expand.
- Changing enzyme activity. DNA methyltransferases add methylation and TET enzymes participate in active demethylation pathways; inflammatory context may disturb their targeting or balance.
- Cell selection. A methylation state that supports survival under chronic inflammatory stress may become more common as that cell clone expands.
- Changing cell mixture. Inflamed biopsies contain different proportions of epithelial, stromal, and immune cells. Because each cell type has its own methylome, bulk-tissue differences can appear even without a change inside any one cell type.
That last point is crucial: a “UC methylation signature” may contain both within-cell epigenetic remodeling and between-cell compositional change.
What happens downstream?
The effect depends on genomic context—not simply “more methylation means less gene expression.”
Promoters and transcription start sites
Dense methylation at some promoter CpG islands can reduce transcription-factor access and recruit methyl-CpG-binding proteins and repressive chromatin machinery. This may silence genes involved in cell-cycle control, DNA repair, apoptosis, epithelial adhesion, or signaling.
Enhancers
Methylation changes at enhancers can alter transcription-factor binding and the long-range regulatory contacts that tune when and where genes are expressed.
Gene bodies
Gene-body methylation is common and can correlate with active transcription, exon use, or suppression of inappropriate internal transcription. Its meaning differs from promoter methylation.
Repetitive DNA and genome stability
Loss of methylation across repetitive elements may contribute to abnormal repeat activity and genomic instability. Cancer genomes can therefore show local promoter hypermethylation and broader hypomethylation at the same time.
What has been observed in UC?
Studies have reported aberrant methylation in inflamed, non-neoplastic UC mucosa and in colitis-associated dysplasia and cancer. A study of cancer-free UC mucosa found promoter-CpG-island hypermethylation associated with disease duration and severe phenotype (DOI: 10.1097/MIB.0000000000000990).
A systematic review of UC-associated cancer identified candidate methylated genes including RUNX3, MYOD1, CDKN2A/p16, EYA4, and ESR1, while also finding that the overall pattern differs from sporadic colorectal cancer. Other studies have examined inflammation-related genes, DNA-repair genes such as MGMT, and CpG-island methylator phenotype panels.
These examples are candidates, not a universal progression panel. Findings vary with tissue region, cell composition, assay, disease activity, treatment, age, and study design.
Why paired tissue and plasma help
Tissue shows whether a methylation change is present in the affected colon, but bulk tissue may be distorted by inflammation and cellular mixture. Plasma is less invasive and may carry colon-derived cfDNA, but it is diluted by DNA from blood and other tissues.
Within-person comparison can ask:
- Is a tissue DMR detectable in plasma?
- Does the direction agree across specimens?
- Is the plasma signal related to fragment length or tissue-of-origin features?
- Does it persist after accounting for inflammation and immune measurements?
Agreement strengthens a candidate interpretation. Disagreement can reveal dilution, sampling heterogeneity, blood-cell contribution, or technical effects.
Chronic colitis can create conditions that reshape or select methylation patterns, but a measured difference is not automatically a causal gene switch. Genomic location, cell type, disease activity, expression data, and independent validation determine what the mark means.
Learn how EM-seq measures the marks → · See why tissue and plasma are paired → · Read the clinical progression context →